Search PMN  

 

PDF version
for printing

Peer Reviewed
Impact
Statement




© 2008 Plant Management Network.
Accepted for publication 17 June 2008. Published 19 August 2008.


First Report of Tomato Yellow Leaf Curl Virus in Greenhouse Tomatoes in Kentucky


P. B. de Sá, K. W. Seebold, and P. Vincelli, Department of Plant Pathology, University of Kentucky, Lexington 40546-0312


Corresponding author: P. B. de Sá. pdesa2@uky.edu


de Sá, P. B., Seebold, K. W., and Vincelli, P. 2008. First Report of tomato yellow leaf curl virus in greenhouse tomatoes in Kentucky. Online. Plant Health Progress doi:10.1094/PHP-2008-0819-01-RS.


Abstract

Tomato yellow leaf curl virus (TYLCV), genus Begomovirus in the family Geminiviridae, was identified for the first time in the United States in Florida in 1997 and since then has been reported in other states on tomato in greenhouse and in field production environments. During 2005 symptoms typical of geminivirus infection were observed on tomato plants grown in a greenhouse production system in Jefferson Co., KY. A nucleic acid-based pathogen detection approach was used and TYLCV infection was confirmed in tomato plants collected from the greenhouse and in symptomless Acalypha ostryifolia growing outside the greenhouse. To our knowledge, A. ostryifolia has not been previously described as a host of this virus. This find raises concerns regarding the introduction of TYLCV to the state in infected transplants or in viruliferous whiteflies transported on infested plants, and its potential impact on economically important crops in the state.


Introduction

Tomato yellow leaf curl virus (TYLCV) is a member of the genus Begomovirus, in the family Geminiviridae. TYLCV has a monopartite genome of circular single-stranded DNA with six open reading frames encoding for proteins in the virus sense and in the complementary sense. TYLCV is vectored by the whitefly Bemisia tabaci (Gennadius) and has a broad host range that includes greenhouse and field crops, ornamental and weed plants. The virus is vectored by B. tabaci in a persistent-circulative manner and may survive between growing seasons in adult whiteflies. Transovarial transmission of TYLCV was reported in B. tabaci for at least two generations under experimental conditions, and it was suggested that the whitefly may function as a virus reservoir between growing seasons (7).

TYLCV causes a severe disease of tomato and was first reported in Israel in 1966 by Cohen and Nitzany (4). Presently it is widespread in tomato-producing areas around the world (5,13). In the United States it was introduced into Florida in late 1996 or early 1997 (14) and has since then been detected in the continental US in the following states: Georgia in 1998 (12); Louisiana in 2000 (17); Mississippi (9) and North Carolina in 2001 (15); South Carolina (11) and Alabama in 2005 (1); Arizona (8) and Texas in 2006 (10); and California in 2007 (16). TYLCV was reported in Puerto Rico in 2001 (2). TYLCV has been found in the US in field and greenhouse tomato-production systems and may have spread by the movement of infected tomato transplants. Movement of infected vegetable or ornamental plants is a potential route for virus introduction into tomato-producing areas, as well as movement of viruliferous whiteflies transported on infested plants. Additionally, TYLCV was successfully transmitted from vine tomato fruit to tomato plants by B. tabaci under experimental conditions (6), and discarded infected tomato fruit could be another potential source of virus. Once introduced, this virus may become established where environmental conditions favor the vector and virus host plants in tropical and subtropical climates. In regions with temperate climates, B. tabaci is a major greenhouse pest (6). Viruliferous whiteflies may overwinter in a year-round greenhouse production system and there is a potential for transmission of the virus to plants growing outside the greenhouse, including field crops and weed plants, during the next growing season.

This is the first report of detection of TYLCV in Kentucky and in Acalypha ostryifolia. A nucleic acid based (NA-based) detection method (18) using PCR was used to identify TYLCV infection in tomato plants growing in a commercial greenhouse and in A. ostryifolia growing outside the greenhouse.


Greenhouse Observations

In mid-October of 2005 tomato plants were found in a commercial greenhouse in Jefferson Co., KY, with symptoms suggestive of virus infection. The plants had been seeded on-site in July and, at the time of these observations, disease incidence was greater than 90%. The symptoms were reduction in leaf size with upward curling of leaf margins, chlorosis and stunting, generally considered typical of infection by a geminivirus (Fig. 1 and Fig. 2). Whiteflies present in the greenhouse were collected for identification and were confirmed to be Bemisia tabaci based on examination of morphological characteristics (Dr. Ricardo Bessin, Department of Entomology, University of Kentucky).


 

Fig. 1. Tomato plants seen in a commercial greenhouse in Kentucky in 2005. Young leaves have marginal chlorosis and reduced size, and older leaves show upward curling or cupping of leaf margins and chlorosis. Symptoms are considered typical of geminivirus infection and were present on approximately 90% of plants.

 

Fig. 2. Detail of symptoms on a tomato plant in the same greenhouse in 2005. Younger leaves are small and distorted with marginal chlorosis and initial upwards leaf cupping. Older leaves have severe upwards cupping. Symptomatic plants have few flowers and fruit.


NA-Based Virus Detection

Observations in the greenhouse suggested that the tomatoes were infected by a begomovirus and a NA-based detection method was used for identification of the virus. Leaf samples were collected from three tomato plants and from symptomless Acalypha ostryifolia, Galinsoga parviflora, and Ipomoea spp. growing outside the greenhouse. Total DNA was extracted from the leaf samples using the DNeasy Plant Mini Kit (QIAGEN Inc, Valencia, CA), and was used for PCR- based virus detection with the degenerate primers prV324 and prC889 (3). These primers amplify the core region of the coat protein (CP) gene of begomoviruses and are useful for provisional virus identification. To obtain the complete sequence of the coat protein gene the primers TYLCV CP-F (5’ CTATGTCGAAGCCACCAG 3’) and TYLCV CP-R (5’ GTAACAGAAACTCATGATATA 3’) were used for PCR amplification of target viral DNA. The TYLCV CP-F and TYLCV CP-R primers are modifications of primers described elsewhere (11). PCR cycling parameters were 95°C for 1 min followed by 30 cycles of 95°C for 30 sec, 55°C for 30 sec, 72°C for 30 sec and a final elongation step of 72°C for 7 min.

PCR products were cloned into the vector pGEM-T Easy (Promega, Madison, WI) and two to three clones obtained from each sample were subjected to DNA sequencing in the forward and reverse directions by automated dideoxy-termination sequencing at the Advanced Genetics Technology Center (AGTC), University of Kentucky. Sequences were compiled, edited, and analyzed using ChromasPro (Technelysium Pty Ltd, Australia) and aligned using CLUSTAL W. BLAST (www.ncbi.nlm.nih.gov) searches were performed to determine percent nucleotide identity with other CP gene sequences.

PCR reactions with the primers prV324 and prC889 and total DNA extracted from samples from two tomato plants and from the A. ostryifolia yielded 579 bp of the core region of the coat protein gene of TYLCV, as indicated by sequence analysis of cloned PCR products. BLAST searches showed that the sequences shared 98% to 99% identity with TYLCV isolates from Texas, Arizona, and South Carolina (GenBank Accession numbers EF 1100890, EF 210554, and DQ 139329, respectively). The complete nucleotide sequence of the TYLCV CP gene was obtained from cloned amplicons resulting from independent PCR amplifications of TYLCV DNA from samples from one tomato plant and from A. ostryifolia. A third tomato sample collected from the same greenhouse was also tested for presence of TYLCV using the CP specific primers only. PCR amplifications of target viral DNA resulted in products of approximately 800 bp. BLAST searches showed that the TYLCV CP gene sequence (777bp) from the tomato and A. ostryifolia samples shared 99% to 100% identity with TYLCV CP sequences reported from Texas, South Carolina, and Florida (GenBank Accession numbers GB EF 1100890, DQ 139329, and AY 530931). Three sequences obtained for the TYLCV CP gene using the CP gene specific primers and total DNA extracted from two tomato plants and from A. ostryifolia were deposited in NCBI GenBank with Accession numbers EU 430290, EU 430291, and EU 430292, respectively. PCR amplifications using the primers prV324 and prC889 and total DNA extracted from Ipomoea spp. and Galinsoga parviflora leaf samples did not yield a PCR product. Some PCR amplification products obtained using primers prV324 and prC889 and total DNA from tomato were not of virus origin as indicated by sequence analyses.


Discussion

This is the first report of detection of TYLCV in tomato in Kentucky and the first report to the best of our knowledge of this virus in A. ostryifolia. A NA-based detection method was used for identification of a suspected begomovirus. The degenerate primers prV324 and prC889 were used initially for provisional identification and TYLCV CP specific primers were used to obtain the CP gene sequences that were deposited in GenBank. Sequence analysis of cloned PCR products indicated that amplification with the degenerate primers prV324 and prC889 also resulted in some amplicons that were not of virus origin. PCR amplification of non-viral DNA in total DNA extracts from plants in the Solanaceae and Malvaceae families has been previously reported to occur sometimes when using these primers (3).

Tomatoes, both greenhouse- and field-grown, are an important part of vegetable production in Kentucky. Given the economic importance of TYLCV in the southern US, the discovery of the virus on tomatoes on a site with year-round greenhouse production, and therefore overwintering potential, raises concerns that TYLCV could become established outside the site of the outbreak and threaten production in years that favor the buildup of the vector, B. tabaci. A recommendation was made that all tomato plants in the greenhouse be destroyed. The plants were buried and the greenhouse was allowed to freeze during the winter to eradicate whitefly populations.

Subsequent visits to the greenhouse in Jefferson Co. later in 2005 and in the spring of 2006 and 2007 revealed neither symptomatic plants nor whiteflies in or around the facility. TYLCV has not been reported in any other part of Kentucky and the original source of inoculum is unknown as the transplants were grown on site. However, the whiteflies found inside the greenhouse and in the outside surrounding area and identified as B. tabaci may have been the source of inoculum for the tomato plants in the greenhouse and for the A. ostryifolia. Viruliferous whiteflies may have been unwittingly introduced into the greenhouse, possibly on ornamental plants, and may have been the cause of the outbreak of TYLCV in 2005.


Acknowledgments

We would like to thank Dr. Ricardo Bessin for identification of B. tabaci and Dr. J. D. Green for identification of A. ostryifolia. We also thank Donna Michael, Jefferson Co. extension agent for horticulture, and Bernadette Amsden for technical assistance.


Literature Cited

1. Akad, F., Jacobi, J. C., and Polston, J. E. 2007. Identification of Tomato yellow leaf curl virus and Tomato mottle virus in two counties in Alabama. Plant Dis. 91:906.

2. Bird, J., Idris, A. M., Rogan, D., and Brown, J. K. 2001. Introduction of the exotic Tomato yellow leaf curl virus – Israel in tomato to Puerto Rico. Plant Dis. 85:1028.

3. Brown, J. K., Idris, A. M., Torres-Jerez, I., Banks, G. K., and Wyatt, S. D. 2001. The core region of the coat protein gene is highly useful for establishing the provisional identification and classification of begomoviruses. Arch. Virol. 146: 1581-1598.

4. Cohen, S., and Nitzany, F. E. 1966. Transmission and host range of the tomato yellow leaf curl virus. Phytopathology 56: 1127-1131.

5. Czosnek, H., and Laterrot, H. 1997. A worldwide survey of tomato yellow leaf curl viruses. Arch. Virol. 142:1391-1406.

6. Delatte, H., Dalmon, A., Rist, D., Soustrade, I., Wuster, G., Lett, J.M., Goldbach, R. W., Peterschmitt, M., and Reynaud, B. 2003. Tomato yellow leaf curl virus can be acquired and transmitted by Bemisia tabaci (Gennadius) from tomato fruit. Plant Dis. 87:1297-1300.

7. Ghanim, M., Morin, S., Zeidan, M., and Czosnek, H. 1998. Evidence for transovarial transmission of tomato yellow leaf curl virus by its vector, the whitefly Bemisia tabaci. Virology 240: 295-303.

8. Idris, A. M., Guerrero, J. C., and Brown, J. K. 2007. Two distinct isolates of Tomato yellow leaf curl virus threaten tomato production in Arizona and Sonora, Mexico. Plant Dis. 91:910.

9. Ingram, D. M., and Henn, A. 2001. First report of Tomato yellow leaf curl virus in Mississippi. Plant Dis. 85:1287.

10. Isakeit, T., Idris, A. M., Sunter, G., Black, M. C., and Brown, J. K. 2007. Tomato yellow leaf curl virus in tomato in Texas, originating from transplant facilities. Plant Dis. 91:466.

11. Ling, K. S., Simmons, A. M., Hassell, R. L., Keinath, A. P., and Polston, J. E. 2006. First report of Tomato yellow leaf curl virus in South Carolina. Plant Dis. 90:379.

12. Momol, M. T., Simone, G. W., Dankers, W., Sprenkel, R. K., Olson, S. M., Momol, E. A., Polston, J. E., and Hiebert, E. 1999. First report of tomato yellow leaf curl virus in South Georgia. Plant Dis. 83:487.

13. Moriones, E., and Navas-Castillo, J. Tomato yellow leaf curl virus, an emerging virus complex causing epidemics worldwide. 2000. Virus Res. 71:123-134.

14. Polston, J. E., McGovern, R. J., and Brown, L. G. 1999. Introduction of tomato yellow leaf curl virus in Florida and implications for the spread of this and other geminiviruses of tomato. Plant Dis. 83:984-988.

15. Polston, J. E., Rosebrock, T. R., Sherwood, T., Creswell, T., and Shoemaker, P. J. 2002. Appearance of Tomato yellow leaf curl virus in North Carolina. Plant Dis. 86:73.

16. Rojas, M. R., Kon, T., Natwick, E. T., Polston, J. E., Akad, F., and Gilbertson, R. L. 2007. First report of Tomato yellow leaf curl virus associated with tomato yellow leaf curl disease in California. Plant Dis. 91:1056.

17. Valverde, R. A., Lotrakul, P., Landry, A. D., and Boudreaux, J. E. 2001. First report of Tomato yellow leaf curl virus in Louisiana. Plant Dis. 85:230.

18. Vincelli, P., and Tisserat, N. 2008 Nucleic acid-based pathogen detection in applied plant pathology. Plant Dis. 92:660-669.