Search PMN  

 

PDF version
for printing

Peer Reviewed
Impact
Statement




© 2008 Plant Management Network.
Accepted for publication 4 May 2008. Published 2 July 2008.


First Report of Powdery Mildew of Chickpea (Cicer arietinum) Caused by Leveillula taurica in Washington State


K. P. R. N. Attanayake, Department of Plant Pathology, Washington State University, Pullman 99164; D. A. Glawe, Department of Plant Pathology, Washington State University, and College of Forest Resources, University of Washington, Seattle 98195; and K. E. McPhee, F. M. Dugan, and W. Chen, USDA-ARS, Washington State University, Pullman 99164


Corresponding author: W. Chen.  w-chen@mail.wsu.edu


Attanayake, K. P. R. N., Glawe, D. A., McPhee, K. E., Dugan, F. M., and Chen, W. 2008. First report of powdery mildew of chickpea (Cicer arietinum) caused by Leveillula taurica in Washington State. Online. Plant Health Progress doi:10.1094/PHP-2008-0702-01-BR.


Chickpea (Cicer arietinum L.) is an important grain legume worldwide. In the USA, major chickpea production areas include the Palouse region of north central Idaho and southeastern Washington, central California, and the northern Great Plains. In October 2007, powdery mildew was found in two chickpea fields in an experimental farm near Pullman, Whitman Co., WA. Although disease signs were observed on all chickpea cultivars in the fields, high incidence (> 80%) was seen only on cvs. Dwelley and Spanish White. Dwelley is widely cultivated in the Palouse region due to its resistance to pathotype I of Ascochyta rabiei, whereas Spanish White is more common in areas with low disease intensity of Ascochyta blight. Typical powdery mildew symptoms and signs were observed on plants in early senescence. Petioles and adaxial leaf surfaces exhibited dense white powdery patches, with areas beneath the fungal growth initially turning chlorotic, then necrotic, followed by defoliation (Fig. 1).



 

Fig. 1. Chickpea leaflets with signs of infection by Leveillula taurica.

 

Branched or unbranched conidiophores typically developed from internal mycelium and emerged through stomata singly or in groups of one to five (Fig. 2). Conidiophores bore hyaline primary and secondary conidia (Figs. 3 and 4). Primary conidia were lanceolate, (47.5-)50-66.5(-68.5) × (13.5-)14.5-20.5 µm; secondary conidia were ellipsoid to cylindrical, and measured 46.5-62 × 14.5-18.5 µm. The teleomorph was not observed. Morphological features of the anamorph fit the description of Leveillula taurica (Lév.) Arnaud. (1). Total DNA was extracted from conidia and mycelia, and the internal transcribed spacer (ITS) region of nuclear rDNA was amplified using PCR primers Lev3F (GACTGCCTAGCGGTCCTCTG) and Lev3Rb (GAAAGCACCACCGGCACCGCCACTG). PCR products were purified and sequenced on both strands. Sequence comparisons by using BLAST searches (www.ncbi.nlm.nih.gov/BLAST) found that the sequence was identical to fifteen accessions of L. taurica in GenBank including a local isolate (AY912077) reported from the monocot Triglochin maritima (Juncaginaceae) (4). The ITS sequence of the chickpea isolate was deposited at GenBank (accession number EU437785).


     
 

Fig. 2. Conidiophore (CP) of Leveillula taurica emerging through a stoma (S). Bright field. Bar = 50 µm.

 

Fig. 3. Primary (P) and secondary (S) conidia, photographed in air. Bar = 50 µm.

 

 

Fig. 4. Detached primary (P) lanceolate conidium, and secondary (S), cylindrical conidia. Bar = 50 µm.

 

Leveillula taurica occurs on a broad host range comprised of more than 70 plant families including monocots and dicots from all over the world. In the Fabaceae, Acacia, Cicer, Lathyrus, Lens, Lupinus, Medicago, Melilotus, Phaseolus, Pisum, Vicia, and Vigna are hosts (1,3). L. taurica is an emerging plant pathogen on vegetables (potato, onion), ornamentals (Gaillardia × grandiflora), and native plants (Triglochin maritima) in the Pacific Northwest of the USA (3,4). Wide occurrence of L. taurica on many crops and native plants suggests that this pathogen has become established in the Pacific Northwest, and such a wide host range may complicate management practices for this pathogen on chickpea and other crops in the region. To our knowledge this is the first record of powdery mildew caused by L. taurica on chickpea in Washington state, although the pathogen has been reported from chickpea in California (2) and elsewhere, e.g., Ethiopia, India, Iran, Morocco, Pakistan, Sudan, Turkey, and the former USSR (3). Powdery mildew of chickpea has been documented as a severe disease on at least one chickpea cultivar in India (5). In Washington state, the disease occurred late in the growing season in 2007, and there was no economic impact on the chickpea crop. Therefore, no control measures were necessary. However, further research on control would be needed if, in the future, the disease occurs earlier in the season and results in yield losses.


Literature Cited

1. Braun, U. 1987. A monograph of the Erysiphales (powdery mildews). Beih. Nova Hedwigia 89:1-700.

2. Buddenhagen, I. W., Workneh, F., and Bosque-Perez, N. A. 1988. Chickpea improvement and chickpea diseases in California. Int. Chickpea Newsl. 19:9-10.

3. Farr, D. F., Rossman, A. Y., Palm, M. E., and McCray, E. B. 2008. Fungal Databases. Online. Systematic Mycology and Microbiology Laboratory, USDA-ARS, Washinton, DC.

4. Glawe, D. A., Dugan, F. M., Liu, Y., and Rogers, J. D. 2005. First record and characterization of a powdery mildew on a member of the Juncaginaceae: Leveillula taurica on Triglochin maritima. Mycolog. Prog. 4:291-298.

5. Nene, Y. L. 1988. Multiple-disease resistance in grain legumes. Annu. Rev. Phytopathol. 26:203-217.